Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14292D8
Clone ID IST14292D8
Vector VICTR74
Project tigm

Sequence tag IST14292D8HMR1
Sequence
TATGGTATTTTGTCTGATTATGTATATGCNCCGTGAGCATGCCTGGTGCCTGCNNAGGCCTTGANAGGGCATTANAACCT
CTGCATCTGGAGTTACAGATGATGGGTGTGAGCTGCCNNGCGGGTGCTNCNNGTAANCNANAGGANCCNNTGTGTGTTCC
TAACCNTGANCCACCTCCNNCCCTTCATCTGCANCTACTAAANANGCTGCGGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14292D8HMF1
Sequence
ATTTACATTTCAAATGCTATCCCGAANGTCCCCTATACCCTCCCCCTGCCCGTGAAATAAATCTTAAAAAGAGAACAAAG
TTGCCTATGGCAGANCATACCCCTAGAAGTCTAACTGTTCTGGTAGAAGGAGCGTCACATAAATAAGGACAGTGATTGTA
GGTTTCCCCTGAAGTTTTTGCTAATGTTGCATTACTCGATCATGAATGGCCCCTTGCTATGTCTTGGTCTTCTGACCTCT
TTCCTAGTTTACTAATCTCCGTGCCTGGCAGATTTCCCTGACAAGGAGCCATAGTGGCTTTCTCTTTTATAGANGCTTGC
TGCCTCCTTCATGTGACCCCGCAATCTTCAGCTNGGGCANTTGTGGANACAGGGTTTGATTGTTGTGATTGCANTGCTAT
CTGCATCTANTGGGGANAGGCCAGANATCCTGNTAAATGNNCTGTAATGTGCTGAACAGCCCCCC
Sequence Type genomic DNA
Unitrap ID UNI4828

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95074942..95075405 438
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015711 (Prune) NM_173347 prune homolog (Drosophila) Gene [Source:MGI (curated);Acc:Prune-001]


Sequence tag IST14292D8BBF1
Sequence
ATTTACATTTNAAATGCTATCCCGAAAGTCCCCTATACCCTCCCCCTGCCCGTGAAATAAATCTTAAAAAGANAACAAAG
TTGCCTATGGCAGANCATACCCCTANAAGTCTAACTGTTCTGGTANAAGGAGCGTCACATAAATAANGACAGTGATTGTA
GGTTTCCCCTGAAGTTTTTGCTAATGTTGCATTACTCGATCATGAATGGCCCCTTGCTATGTCTTGGTCTTCTGACCTCT
TTCCTAGTTNACTAATCTCCGTGCCTGGCAGANTTCCCTGACNNNNANCCNTANTGGCTTTCTCTTTTATANANGCTTGC
TGCCTCCTTCATGTGACCCCGCANTCTTNANCTANGGG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000015711


For any suggestions or comments, please send an email to unitrap@crg.es