Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14216A10
Clone ID IST14216A10
Vector VICTR74
Project tigm

Sequence tag IST14216A10HMF1
Sequence
TTACTAAGGTCACCGTCCGTGGCTGCCTGGGTCGGGGGTCTCACCTATGCCGCGTGTCTCTGCTCNATTCTCCAAAGCAG
GAACTCGCTGACAGTCGGCCCTGCCTGCCTGGANGAGGCCGCTCCTCCGGANGCTCTGGGGCCGGANACAGCCTTCACCA
GCTCGCCCAGCTCACCTGCGCAATCNCCCTCCANGCCGAANACCCCCAGGCTCNNCGGGCANCGTGGGTCACGTGGTCTG
TGGGCGGGGCTCGTCCGCNCGGACNTNNTCACACGACCTCCTGCGTANGCGGCGGANTCCGTGTGANTGTTAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14216A10HMR1
Sequence
TTAAGACAGCAGGCTCCGGTAAAGTCCGGGATTCTAGTTCGTGCCCGCAGTACCAGGCGGGCAAAGCTCTGTGTGTATGT
GACGCAGGGGGAAACTGAGGCACAGAGAAACCGAGAACCTTCACTTTGACCTCCCGTGTCTGACAGGTTGGATTTGGACA
CGCCTGTGCCTGGTGACGCAGCGATCCAGCTGCTTTCCAGAAAGCAAGCTTGAGGTCACCAGGTCANCCGTGGCCTCTGA
NTTNANTTCCTTCCCATGTTTTTTTCTCTAAATTGTGGCTGAGAGAACGGGCCNNANCTGCCTGCTCCCANTTTCTGGGA
CTTTGTTCTAATGCNTGTGTTTCTGANTTGCGCCCNGCNNCCTA
Sequence Type genomic DNA
Unitrap ID UNI34265

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 119129578..119129939 336
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025579 (Gaa) NM_008064 glucosidase, alpha, acid Gene [Source:MGI (curated);Acc:Gaa-002]

 
Come back to gene ENSMUSG00000025579


For any suggestions or comments, please send an email to unitrap@crg.es