Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14729B5
Clone ID IST14729B5
Vector VICTR76
Project tigm

Sequence tag IST14729B5BBF1
Sequence
ACCCGATCTCAAAGACCTTCCCAAGTACCTGGGCTGAGTCTGGGGATGTTAAAAGGAGGGTAAAGATACATGGACTGTGA
CCCTATCTCAGGCTGAAACATCCCTAGGAACTGGTGATCATACACATCTGCCAAAACCCAGCATCCCAAGGTCCCCAAGG
CAAGCCCGCTTACACTGCCTAATGCTCCCTCTGTCCCCTCCAGGGCCAGTGGCCAGCCCTTTCCTGGGCAGGGACTAAGT
GAACTGATACCTTAATGGTTCAGCAAACTCATAGACCATACAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 110525919..110526205 287
 
EST/CDNA Est Name
  BY348584.1 - BB873695.1 - BE137410.1 - BQ555881.1 - W85483.1


Sequence tag IST14729B5HMF1
Sequence
ACCCGATCTCAAAGACCTTCCCAAGTACCTGGGCTGAGTCTGGGGATGTTAAAAGGAGGGTAAAGATACATGGACTGTGA
CCCTATCTCAGGCTGAAACATCCCTAGGAACTGGTGATCATACACATCTGCCAAAACCCAGCATCCCAAGGTCCCCAAGG
CAAGCCCGCTTACACTGCCTAATGCTCCCTCTGTCCCCTCCAGGGCCAGTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 110525919..110526130 212
NO GENE  


Sequence tag IST14729B5HMR1
Sequence
GGTGATTTCTATCCTGAGCTGTACCCCATGCCACCAGCTTTGGCTAGCAGGAGCCAGTTGTTACCTCCACCTATTTGACA
CAGGAGAAACTGTTCCAGCCCTGGTGTGAATCAGGATGGACACACACGCTGCCCCCAGGGACTCCTGACAGCAGATCTGA
GGATTTCTTCATATTTCTGCAGAGTTCCTCCTTCTGAGATTCAAGAGAANCAGGCTCCAAGCTCCGTCC
Sequence Type genomic DNA
Unitrap ID UNI15873

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 110525694..110525921 226
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032491 (Nradd) NM_026012 neurotrophin receptor associated death domain Gene [Source:MGI Symbol;Acc:MGI:1914419]

 
Come back to gene ENSMUSG00000032491


For any suggestions or comments, please send an email to unitrap@crg.es