Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14718H2
Clone ID IST14718H2
Vector VICTR76
Project tigm

Sequence tag IST14718H2HMR1
Sequence
AGATGCTAAATTAGCCNCTCTTACCTTGAAACCGTTTCCCTAATNACTTGGTGGAAGGATGATGTAAATAAAAATCGCCC
CCTAACACAGAG
Sequence Type genomic DNA
Unitrap ID UNI1455

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 104164227..104164318 88
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054574 (AC145736.4-202) Putative uncharacterized protein Fragment [Source:UniProtKB/TrEMBL;Acc:Q8BNL1]


Sequence tag IST14718H2BBF1
Sequence
CTTACAATAGGGGTTTTTTGGGGGGCGGGGGCACGCAGGTGTACTCTCAACACCCACTTCATTGGGCGTCCAAAGTGCTG
CTTCACCTACACCAAAAGCCGCGTTCAGAGGTGAAATCACAGCCCAGCACGGGCAACAGTGAACAGGCCAGGCTACTTTA
CAAGAAGGAAAAGCCTTGGGGGGAAAACTTGGTGTTTGATAAAGGACTTGAGGAAGAGAACAGCAGCTGCCCCTCCTTTC
CCATCAAATCGAAACAAAACTGAGACGAGGAAAAAAGAAAGAAAAAAAAAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 104164317..104164610 294
 
EST/CDNA Est Name
  CJ081074.1

 
Come back to gene CJ081074.1


For any suggestions or comments, please send an email to unitrap@crg.es