Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13660B2
Clone ID IST13660B2
Vector VICTR74
Project tigm

Sequence tag IST13660B2BBF1
Sequence
AGCATATTCACCAGCGTCTGTACCAAGTCTCATATTCTGAGCCAAGCACCATGAGGGTCCCTGGTGGCTGAAACAGCAAG
CATGGTGATACACTCCTGTGACCTCAGCACTCAGGAAGTANAAGCAAGACTCCAGTGAGCTTGAGGCCAGACACTGTTCA
ACGCCTTCCCTGCACCAGTCGATGGGGCTGGAGATGAGGCCTGCATTCCCAGCAGTTGGGAGACTCACAACCACTGCTAA
GCCCAGATCCAGGGATCACGTGCCCGGACCTGGTACANAAACCATACACATAATTTAAAAATATATATATATTAGAGGAA
AAGAAGTCGAAATTTAACATTATACTGCAACAGTGCCAACTGCCTTTCCTATTTTTGCTTCTTCACTGGATTCNACTACT
ATAACTGGGGGTTGGGGGCTTCNTGTGNACCCTGGCTGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 34935210..34935649 426
NO GENE  


Sequence tag IST13660B2HMR1
Sequence
TGCTCATTAGACACTAGTCTAGACTTCTCTCATATTCTCCTAGACTACAGACTGCTCTCTTTTTTGTACAATGATCTTCT
GTGTTTCTTTCCCTCCCTCCCATCATCATCATCATTTTATTTTTTTAACTATGTAGCTCAGGTTGGCCTTGAACTCTTTT
TTAAAGATATTTTATTTATTTTATGTATATGAGTACACACTGTAGCTGTTCAGTTGGTTGTGAGCCTTCATGTGGTTGTT
GGGATCTGAATTTAGGACCTCTGCTCGCTCCAGTCAATCCTGCTCGCTCAGGTCCGCCCCACTCAATCAGTCCCTGTTCG
CTCCAGCTCAAAGATTTATTCTTTACATAAATAAGAACACTGTAGCTATGGCGTCAGATCTCATTGCGGGTGGTTGTGAG
CCNCCATGTGATGAACTCNNAACCTTTGGAAAAGCNNTCAGTGCGTTTACCTGCTGAGCCNTCTCANCAGTCCCTGGCCT
TGAACTCNNGNNCCTTTTGTCNGAA
Sequence Type genomic DNA
Unitrap ID UNI29695

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 34935646..34936149 480
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029106 (Add1) NM_013457 adducin 1 (alpha) Gene [Source:MGI (curated);Acc:Add1-002]

 
Come back to gene ENSMUSG00000029106


For any suggestions or comments, please send an email to unitrap@crg.es