Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_117C3-3
Clone ID CMHD-GT_117C3-3
Vector GepSD5
Project cmhd

Sequence tag CMHD-GT_117C3-3
Sequence
ACATCCACAAATGTGGAATGAAAAACAAAAATAACATCCAAGTTGATGAAGCTAATATATTGACTTGGCAAGGGCTTATT
GTTCCTGACAACCCTCCATATGATAAGGGAGCCTTCAGAATTGAAATCAACTTTCCAGCAGAGTATCCATTCAAACCACC
CAAGATCACATTTAAAACAAAGATCTACCACCCTAACATCGATGAGAAGGGGCAGGTCTGTCTGCCAGTCATTAGTGCTG
AAAACTGGAAGCCAGCCACCAAGACTGACCAAGTAATCCAGTCGCTCATAGCACTGGTGAATGACCCCCAGCCTGAGCAC
CCACTCCGGGCTGACCTAGCTGAAGAATACTCNTAAGACCGTAAAAAATTCTGTAAGAATGCTGAAGAGTTTACAAAGAA
ATATGGGGAAAAGCGACCTGTGGACTAAAATCTGCCATGAGTGATTCCAGCAAGTTTGAGCAGAGACCCCGAGCAGTGCA
TTCAGACACCCCGCAAAGCAGGACTCTGTTGAAATTGACACGTGCCACCAACTGGCGTCCGCTTGTGGCAG
Sequence Type mRNA
Unitrap ID UNI14005

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 87011340..87288762 517
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074506 (AC102115.11)  

 
Come back to gene ENSMUSG00000074506


For any suggestions or comments, please send an email to unitrap@crg.es