Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10374C9
Clone ID IST10374C9
Vector VICTR76
Project tigm

Sequence tag IST10374C9HMF2
Sequence
CCCCCAAGCCCCACAGCTCCCAGTCCCTCACTCCAGTGCCAAGCCTGCCTGCTGCCACGGGCTCACCCTCTGAAACTGTA
AACAAGCCCCCAGTTAAATGAGTTCTTTCATACGCTTCCTAAGTCANAGTGTCTCTTTACAACAACAGAANAGTTGCTAA
GGCCAACTTGTGGGGAAACACCGTGCCTGGATCTGTGGTTTAGCGCTCTGTGTAGTCTCTGTANCANCATTATGCAGCCA
ATATTGAGAACTTTGTTCGGTTTTTCTGCATCTGTTCTGCACTCCACATATGGA
Sequence Type genomic DNA
Unitrap ID UNI19527

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 117027319..117027611 285
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028677 (Rnf220) NM_025739 ring finger protein 220 Gene [Source:MGI Symbol;Acc:MGI:1913993]


Sequence tag IST10374C9BBF1
Sequence
AAGGCTTTCTTCAGCCTGGTCTTATTGCCTGATTGATTTCATTCTCCTCCCCACTCCTCATGTGCCCAACGTATGTTTCT
ATTGCAACATTTAAGCTGTATTTAGGTATACTCTTTACAGGTGTATTCATTANCCATTTTAAGAGTATTATTTCATTTAA
AGTGTTTGAAAACTTGCTTCTTATCAATTAAACTTTCAGGTGTAGATATATACTTCTAAGAAAAGTATATTAAAAGTTAT
TGATAATGAAATACAGAATATGTTTATGTTGATTAATTAATATATTCTTTTTGCTCTTCTGTTACTGAGGTTCAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 30856555..30856873 317
 
EST/CDNA Est Name
  AA674991.1

 
Come back to gene AA674991.1


For any suggestions or comments, please send an email to unitrap@crg.es