Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12324D8
Clone ID IST12324D8
Vector VICTR76
Project tigm

Sequence tag IST12324D8BBF1
Sequence
TTTATTACATGTAAGTACACTGTAGCTATCCTCAGATACTCCAGAAGAGGGAGTCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI4639 UNI16700 UNI22302 UNI34271 UNI34272

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 119641113..119641173 61
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 100279569..100279629 61
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001555 (Fkbp10) NM_010221 FK506 binding protein 10 Gene [Source:MGI (curated);Acc:Fkbp10-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 25440792..25440852 61
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000066553 (AC125067.4) Cox7a2l protein [Source:UniProtKB/TrEMBL;Acc:Q99KD6]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 78794690..78794750 61
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033088 (Triobp) NM_001024716 TRIO and F-actin binding protein Gene [Source:MGI (curated);Acc:Triobp-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 96581314..96581374 61
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 31574249..31574309 61
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041119 (Pde9a) NM_008804 phosphodiesterase 9A Gene [Source:MGI Symbol;Acc:MGI:1277179]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 3571926..3571986 61
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024908 (Saps3) NM_029456 SAPS domain family, member 3 Gene [Source:MGI Symbol;Acc:MGI:1921807]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 44173391..44173451 61
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 87105873..87105933 61
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 56870365..56870425 61
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 77653995..77654055 61
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 148929819..148929879 61
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 133566129..133566189 61
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114316169..114316229 61
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 37256587..37256647 61
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 45883908..45883968 61
NO GENE  


Sequence tag IST12324D8HMF1
Sequence
TTTATTACATGTAAGTACACTGTAGCTATCCTCAGATACTCCAGAAGAGGGAGTCAGATCTCATTACGGATGGTTGTAAG
CCACCATGTGGTTGCTGGGATTTGAACTTCGGACTTTCGGAGGAGCAGTCGGGTGCTCTTACCCACTGAGCCATCTCACC
AGCCCCATCAGGGTGTTTTAACCCAGAAACAGGAAACAAAACGGAGACCGAGGGAGCCTTACATGCATGCAAGCATACAA
TTGATGTCCTAGATTCCTTTGCGTTTAAAACTGGGCTACTTTAGAGCTACCGAGGTTTATCTAGCACACAGCTTGGAATC
TGAAGATCGAAGATCGAGTAGCCNTGTCTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 119640823..119641173 349
NO GENE  

 
Come back to gene ENSMUSG00000024908


For any suggestions or comments, please send an email to unitrap@crg.es