Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14344E11
Clone ID IST14344E11
Vector VICTR74
Project tigm

Sequence tag IST14344E11HMR1
Sequence
GAAAGAAAGAAAGAAAGAAAGAAAGAAAGGAAGGAAGGAAGA
Sequence Type genomic DNA
Unitrap ID UNI31117 UNI31118 UNI31119

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 14351160..14351201 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6417560..6417601 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 20319294..20319335 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 7806878..7806919 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 5368361..5368402 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 7591312..7591353 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 7071907..7071948 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 5867641..5867682 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 11236017..11236058 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 4134246..4134287 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 3729815..3729856 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 11162630..11162671 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 11514651..11514692 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 10217943..10217984 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 4476533..4476574 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 3411785..3411826 42
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044156 (Hepacam2) NM_178899 HEPACAM family member 2 Gene [Source:MGI Symbol;Acc:MGI:2141520]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 4712136..4712177 42
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049952 (4930401F20Rik) RIKEN cDNA 4930401F20 gene Gene [Source:MGI Symbol;Acc:MGI:3045311]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 12412099..12412140 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 11284412..11284453 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161872: 324394..324435 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161906: 367146..367187 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161916: 615395..615436 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161923: 1037217..1037258 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166328: 54911..54952 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166369: 220026..220067 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166385: 318885..318926 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166421: 415093..415134 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166451: 1917..1958 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 9022610..9022651 42
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015340 (Cybb) NM_007807 cytochrome b-245, beta polypeptide Gene [Source:MGI (curated);Acc:Cybb-001]


Sequence tag IST14344E11BBF1
Sequence
ACCCTGCAACAGAGGACAGAGAAAATTACAGAGAAGCCAAAGCATAAGTGACTGCCTGGCAACAAGAGTGCTTTCAGATT
GCCAGGGCTAAAGCGACAAAGGGCACAGTGTGATAGAGTACGGGCTGATGTAAACTGCTAAAATTTAAATATCAAAAAAG
AGGGATTTTTTTCCCCCAATTTTTTTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 48640679..48640866 188
NO GENE  

 
Come back to gene ENSMUSG00000015340


For any suggestions or comments, please send an email to unitrap@crg.es