Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13663C12
Clone ID IST13663C12
Vector VICTR74
Project tigm

Sequence tag IST13663C12BBF1
Sequence
ANGTNTAACGCTCCTGACAGGAAATCCGGGTTTTTGGATCT
Sequence Type genomic DNA
Unitrap ID UNI22426

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28117087..28117124 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040488 (Ltbp4) NM_175641 latent transforming growth factor beta binding protein 4 Gene [Source:MGI (curated);Acc:Ltbp4-001]


Sequence tag IST13663C12HMR1
Sequence
CATCTACACAGTGGGATAAGGACAGGCCCCTGCGGCAGTGCGTACTAACCAAGCCCCTAAGTGGGGCTCCAGGGTGCAGC
TGCAGCTTGACCTCACTGTCACTTCGGTCGTGTGTTTGGAGCTGCCAAAAGCAAGTCAGGAAACCACTGAGATCACGTGT
GCTTTGCAGGCTTTGAGGGGCAGT
Sequence Type genomic DNA
Unitrap ID UNI12398

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 147457720..147457903 184
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029007 (Agtrap) NM_009642 angiotensin II, type I receptor-associated protein Gene [Source:MGI (curated);Acc:Agtrap-001]

 
Come back to gene ENSMUSG00000029007


For any suggestions or comments, please send an email to unitrap@crg.es