Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10978G6
Clone ID IST10978G6
Vector VICTR76
Project tigm

Sequence tag IST10978G6HMR1
Sequence
TAAGGTGAGAAGATCTGACAGGAGCAAGAGCTAGGCACCCCAGGTAGCCTTTTGTTCTGAGGATCTGACATTCCAGCCTT
TTTGTCAATGATAAAGGCAACATAATCTCTCATAATTC
Sequence Type genomic DNA
Unitrap ID UNI19786

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 100447911..100448027 117
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031325 (4930519F16Rik) RIKEN cDNA 4930519F16 gene Gene [Source:MGI Symbol;Acc:MGI:1922356]


Sequence tag IST10978G6HMF1
Sequence
NTTACCAGCTACCCTAANCNNNNNTNGCCNCCNGACACCTGGGGTCTTTTCCTTCCCTTCTCCCAAATTCTAATTTCTAT
TAAAAAAACAAAAAACAAAAAACCTGGAGGGGGGGAAACCTGACATTTTGGA

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000031325


For any suggestions or comments, please send an email to unitrap@crg.es