Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_118H3-3
Clone ID CMHD-GT_118H3-3
Vector GepSD5
Project cmhd

Sequence tag CMHD-GT_118H3-3
Sequence
CAAATGAAGCTGGTGGCAGAAAACCTGAAGGAGGAGTACCAGGAAGATGGGAAGGAAGCTACCTGAGCTGCACCATGCTG
GCCGTCCTGTCCCCTGTGCTGAAGGACACCTGCATCACACCTGCACAGGGAGGGGACAGCAGCCTGAACTTAGCCCTGAT
GCTGGGCTGTGTGAAGTGGCTAATATGCAGCAGGCACACCAAGGTCTAGCTCTGTGGGAAAAGTGGCTGAGGCTCTCTCT
CAGTACCTCTTTCCCTGGTGCCTCTCACTCGGACCCTCCCAGGGCCGCACACACCCTCCAGCTGTTTCATCACTTTGCTC
AGGAGCCTCAGCTGCCTTTGAACGTTATCCCTAAAGAGTCACCAGCTTTCCACATGACATTCACAGTANGTGCCAGTCAC
TTCTAACCCCAGGGACCCTATTATGGGGTGGTGGCTTAGTGTCTGTGCCCATTATACCCATGGTGGGA
Sequence Type mRNA
Unitrap ID UNI2815

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 122085129..122085596 466
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037949 (Ano10) NM_133979 anoctamin 10 Gene [Source:MGI Symbol;Acc:MGI:2143103]

 
Come back to gene ENSMUSG00000037949


For any suggestions or comments, please send an email to unitrap@crg.es