Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13986B3
Clone ID IST13986B3
Vector VICTR74
Project tigm

Sequence tag IST13986B3HMF2
Sequence
GTTGCAAAGCATTTCTGGGAGCTGCATGTGGGTGACGCAGCAGCATTGTTCGCAGGCACAGGAAGCCGCGGCTGAGCTGA
AGGGCTTTAGAAGGAGCTCAGAGTGCTCCACGCTGTTCTGAGTAGCCTGACGGGCTATAGCAGGACTGCCCTACCTTACA
TGCTCTGGGAGATTCGGGATTTTCACGAAAATCAGGATTTTCCTAGAAGCAGAAAAGCTAACTCCTTCCGCACAACTTCA
ACACAGAAAACAAAACAAAGGCGCTGGGGAAACTTCACCCAAGAGCCTCCGCAGCTCCAGANCAACAAGAAATGCAAGGT
CAGGCGGTCGGTTGGCAAGCCTTTTCTGGTTTGGGGTGTGTATAACTGTAGANACTTTGTCTCTANCN
Sequence Type genomic DNA
Unitrap ID UNI13020

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4333576..4333960 381
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054611 (Fbxl11) NM_001001984 F-box and leucine-rich repeat protein 11 Gene [Source:MGI Symbol;Acc:MGI:1354736]


Sequence tag IST13986B3BBF1
Sequence
TTAGTAAACATTTAGCTGGTACTAGCCACCATGAGGGAAGGGTCACAGGTGAGGAAACAGACACCAGAAAGGAACCTAGC
AAGAACCAAGCCAGGCAGCTTATCCATAGGGACTGCTCTCTGGCCCGACCACCATAGAATGAAAATGGATGGTGAATCCC
CATTTGATGCCAAACAGCCCTATCAGTCTGCCAGCTGAGCTGTGTGAAACTTAGCAAGAAGCTTAACTTCTCTGTGCAGC
GGCTTCTTGGCCTGTCTCCTATGTCCCTTGAGCTGACGGTGGTTAGGAAAGAATGAATTATTAAGTCTTTGGAAATACTA
GCCAGACTCTGTTCCAGGGCTGTTCACTGTGGCCNTCTTGCTCACTGTGGGCCGAGTCTGCTGTGTCCTGTANCCCACTG
ACCGTAAGGCCTTCTTANTTCTCTGTCTCTGTCTCTGAAACAANCTCTTGCCCAGTANTCCNGGCANGCCTGANCTTGCC
ATGGANNCNNGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 47648943..47649426 468
NO GENE  

 
Come back to gene ENSMUSG00000054611


For any suggestions or comments, please send an email to unitrap@crg.es