Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10045H8
Clone ID IST10045H8
Vector VICTR75
Project tigm

Sequence tag IST10045H8BBF1
Sequence
GCACCCACACATAGGATAAATAAACCAATGAAATCTGAGAAAACAACATGTCGCTACTGCTTTGCAGAACCATTGCTCCC
CCTTCCTCAGGGAGAAAGGGTCAGGCTGCCAGCTAAAAGGCTGGCCTGGGGGCTCTCTCCAGGGCTCCCTGCAGTGTGGC
CTGTTTGTCTAAGTGGGGAACACATGCTTTTCCTGGACCATCACTGCTTTCTCTCTGGAGGTCCATCAATCCCACTGGTG
AGGCCGGGTAAGACACAGACAGAGGGAGGCCACCACAATGAGGGACAGAACTTGGAAGGAAGAGATATCAGGGCTGGTTA
AGAAAGGGAGGGAGTTCTGAGACTTTAGGACACTGTGGCGGATGGAAAAACATCACCGCACAGTTAACACCGGGATTCAG
TCTAGAAGGTGCAGATGGAGACCATCCCTCAGACCCACTGTCTGAGACCCACAAAGAAGCTGGAGAAGAAAATCCTGACC
TATTATGACCTGTTCCATCTAGCTCTGACAGGGCCCAAGGAAAGGTGAAAAGCCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 117040876..117041412 503
 
EST/CDNA Est Name
  CA463153.1 - CN660411.1 - CN662315.1 - CN662953.1


Sequence tag IST10045H8HMR1
Sequence
GGTGCCNTCTGTCCNATCTCCAAAATGAGGCACAGCCGGGACTCTAAGCCACCCCAAGATCCCTGTCCTCAATGGACAGC
TCTGAAGGGTCCTAGAAACAAACTTAAGTTTGAAGTTTATCCCAGGCAGAGCAGAAGCTTGGGAAGGCCTCGGGCCTTAG
AGCGCTATTGACCTCTACATAGAAGGAGACGGGCTAGGGGATGCGGGCCGTAGCTCAGTTGGTAGAGTGCTTGCCTAGCA
CGCACAAAGCTGGCGTTCAATCCCTAGCCCGGCAAACAACTGGGCTGTAGACTGCCTCCTGCCAGCTCTCCATCCTAGTA
GGCCCTTGAGCAAGGCCAGGAGGTACTGGGGGGCTTANAGAAATGGNCTANGGN
Sequence Type genomic DNA
Unitrap ID UNI19527

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 117040508..117040880 363
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028677 (Rnf220) NM_025739 ring finger protein 220 Gene [Source:MGI Symbol;Acc:MGI:1913993]

 
Come back to gene ENSMUSG00000028677


For any suggestions or comments, please send an email to unitrap@crg.es