Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14855B12
Clone ID IST14855B12
Vector VICTR76
Project tigm

Sequence tag IST14855B12HMR1
Sequence
AGGAGCTCCTGGAGATTCCAGAACCCGTANATGCTCAAGACTTATATATAATGTATAGAAGTTACCTGTAAGTTGCACAT
CTGCCGCATACCTTAAGTCATCTGCAGATTATGTANCACCAACATTTCTTGATGCATGGTTGGTTGAATCTGTGGCTACA
GAACCTGTTGATATGGAGGTCC
Sequence Type genomic DNA
Unitrap ID UNI15411

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 96825694..96825874 177
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018678 (Sp2) NM_030220 Sp2 transcription factor Gene [Source:MGI (curated);Acc:Sp2-001]

 
Come back to gene ENSMUSG00000018678


For any suggestions or comments, please send an email to unitrap@crg.es