Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12310F5
Clone ID IST12310F5
Vector VICTR76
Project tigm

Sequence tag IST12310F5BBF1
Sequence
TTTGGTAGAGAAAGCAAATCTTGGGCTAGGAGAAGGGGTTCTGTGAGCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI32665

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 5843714..5843766 53
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041798 (Gck) NM_010292 glucokinase Gene [Source:MGI (curated);Acc:Gck-004]

 
Come back to gene ENSMUSG00000041798


For any suggestions or comments, please send an email to unitrap@crg.es