Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AD0858
Clone ID AD0858
Vector pGT0lxr
Project sanger

Sequence tag AD0858
Sequence
GGAGGGATCCATGGAGCTGCTGAAGAAAGGTCTGGAAAGCGGTACAGTGTTGATCCAGTNTGAGCAAACTTACAGAAAGA
AGCCCGGCTTAGCCGTCTCATTTGCAAAGCTGCCTCAGAATTTGGATAAAAACCGATACAAAGATGTGTTGCCTTATGAT
ACCACGCGGGTATTATTGCAGGGAAATGAAGATTACATTAATGCCAGTTATGTGAACATGGAGATGCCCGCTGCTAACCT
TGTGAACAAGTACATTGCCACTCAGGGACCGCTGCCAAACACCTGTGCACAGTTTTGGCAAAGTGTCGGGATCAGAAGTT
GTCTCTTGTTGTCATGCTGACGACTCTCACCGAGCGAGGGCGGACCAAATGTCACCAGTACTGGCCGGATCCCCCTGACA
TCATGGACCATGGCATCTTTCACATCCAGTGTCAGACAGAGGACTGTACCATTGCTTACGTGTCCCGAGAAATGCTAGTT
ACAAACACGGAG
Sequence Type mRNA
Unitrap ID UNI2339

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 57210378..57231444 139
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038764 (Ptpn3) NP_035337 protein tyrosine phosphatase, non-receptor type 3 Gene [Source:MGI (curated);Acc:Ptpn3-001]

 
Come back to gene ENSMUSG00000038764


For any suggestions or comments, please send an email to unitrap@crg.es