Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_118A1-3
Clone ID CMHD-GT_118A1-3
Vector GepSD5
Project cmhd

Sequence tag CMHD-GT_118A1-3
Sequence
CAGAAGAGACAAACCTAAACTCAGTGCCTCAGAAGCTTTGGGGTCTGCAGCGCTCCCCTCCCACTCCTCTGCAATTTCAC
AGCATTCTAAAGGAAGTACGTCCCCCGATTTACTGATGCACCAGGGGCCACCAGACACTGCAGAAATTATAAAATCATTA
CCTCAGAAATACAGAAGGAAACCTATGTCTCAAGAGGAAATGGAATTTATCCAGCGTGGGGGTCCAGAGTGACCGTCGTG
GCTGCTGCTTGTCACCAGACAAGAAGGTTAGCTTTACAATAAAGGACTTCCACAATGTCAAATGAAAAGTCATATA
Sequence Type mRNA
Unitrap ID UNI7918

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 101506127..101511148 189
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061474 (Mrps36) NM_025369 mitochondrial ribosomal protein S36 Gene [Source:MGI (curated);Acc:Mrps36-001]

 
Come back to gene ENSMUSG00000061474


For any suggestions or comments, please send an email to unitrap@crg.es