Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15107D9
Clone ID IST15107D9
Vector VICTR80
Project tigm

Sequence tag IST15107D9HMR1
Sequence
TANTGGGGACATCTGGGTTGAGTCCCANGCATTACTAAACTTACTGTGAATTGCTTGANTTANNAAAGAGGTGAAGGACC
TTTATGTCTTGGGACTCANANACATAATCCCTGACTTAACCTGTGAGGAAAAAAGTGGGGCTAGGCTCCCTGCNNCTCCA
AGGAGGACTTANTGAACTGANCCGGGACTCGTGGTGTT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST15107D9HMF1
Sequence
ATGTGAGTACACTGTTGCTGTCTTCAGATATACCAGATGAGGCATCAGATCTCATTACAGATGTTGTGAGCCACCATGTG
GCTGCTGGGAATTGAACTCAGGACCTCCGGAAGAGCAGTCAGTACTCTTAACTGCTGAGCCATCTCTCCAGCCCATCCTC
Sequence Type genomic DNA
Unitrap ID UNI13373

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 35965938..35966097 160
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022906 (Parp9) NM_030253 poly (ADP-ribose) polymerase family, member 9 Gene [Source:MGI (curated);Acc:Parp9-001]


Sequence tag IST15107D9BBF2
Sequence
ATGTGAGTACACTGTTGCTGTCTTCAGATATACCAGATGAGGCATCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI13373

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 35965938..35965989 52
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022906 (Parp9) NM_030253 poly (ADP-ribose) polymerase family, member 9 Gene [Source:MGI (curated);Acc:Parp9-001]

 
Come back to gene ENSMUSG00000022906


For any suggestions or comments, please send an email to unitrap@crg.es