Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14608C6
Clone ID IST14608C6
Vector VICTR74
Project tigm

Sequence tag IST14608C6HMR1
Sequence
TCTTTGTGATTTTTGTTTGTTTTGACTTTTATGCAGCTGAACAATTTGAGCGGTTCTAAGCCATTTCACCCCCATGTTGC
TGGATTANTATACCCCCAATGTAAAAATACCTAGTCATATGCCCATTCTGGCACCGAAACAGGTCTTCTATTCCATTAAA
ACTCAGGACATTGGTGACCAATACAAGTACCTTAAATACTGGGAGAGTCAAAGATGGACTAANGAAAATNNAATCCCACC
CACCTGACCCTTGCTCTGTCTACTATGTGTGTACCTTGTATATGCNTGCTGGAGTGCATANATTGAACCTNNANTCCTTA
ATTGTTCCACTTTGTTTCTTGACNTANGATCACTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI32275

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 121625879..121626241 341
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027238 (Frmd5) NM_172673 FERM domain containing 5 Gene [Source:MGI (curated);Acc:Frmd5-001]

 
Come back to gene ENSMUSG00000027238


For any suggestions or comments, please send an email to unitrap@crg.es