Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AD0717
Clone ID AD0717
Vector pGT0lxr
Project sanger

Sequence tag AD0717
Sequence
GTCAGACCGTCTGTTTCCAGATGTTGCTTTCCCTAGGAAAACCACACCAGTGCAACATCCCCTAATCTGTTTTACTGAAA
AAGGTGCTGTCTTTTTGGTGTGTGTATGTCTTAGTTTACATCTCTTTCCTTAGCTCCATCCCAGTAGACGCTCAATAGGA
GGTTACTAAATCAATGGAATAAACATTTCAGTTCCTGTTTTTGAGCCCTCCCCCACTTCAGGATATTAATTTGTGGGTGA
ATGAGCTGGGCAGGGATTGGGATTTTACTGGAGAGATTTGGGGTAGACATAGTAGATGAAAGCCAGTTTTATGGGGGTAA
TCCGCTTGAAAAGGATCATGATGAGCGAATCTCTTCAGCCCTGTTTCATTTCCCTGCTTGCTTATCCACAGGACCATGGC
CAACAGTGAGCGCACCTTCATTGCCATCAAGCCTGATGGGGTCCAGCGGGGGCTGGTGGGCGAGATCATCAAGCGGTTCG
AGCAGAAGGGGTTCCGCCTTGTTGGTCTGAAGTTTCTGCAG
Sequence Type mRNA
Unitrap ID UNI2074

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 93827122..93827642 515
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037601 (Nme1) NM_008704 non-metastatic cells 1, protein (NM23A) expressed in Gene [Source:MGI (curated);Acc:Nme1-001]

 
Come back to gene ENSMUSG00000037601


For any suggestions or comments, please send an email to unitrap@crg.es