Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11713G4
Clone ID IST11713G4
Vector VICTR76
Project tigm

Sequence tag IST11713G4HMR1
Sequence
CATGAGGTAATTAATGCCTNCNNNNNANNNTNNNNGNNNNNNNNNCNNNNNNAGTGTTCAGACCTTAGCTCAAAGGGAGA
CCAACCTGTTTATGCTTAGCCCAGTGCCCCACATGAATGTTGAGTTCTCCCCCAGGGCTGGGAGGGGTGAGTGTCCTCTT
GGAGGACAGGCTCAAATGCTAATGTANTGCAAACCACACCTGANATCTGAAAAAGCTCTGGCCCTGGACATGANNCNCAC
TTTANCCTTGAGGAAGGGTGAGACCCA
Sequence Type genomic DNA
Unitrap ID UNI34281

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 22192660..22192925 203
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073168 (EG432637) predicted gene, EG432637 Gene [Source:MGI Symbol;Acc:MGI:3649058]

 
Come back to gene ENSMUSG00000073168


For any suggestions or comments, please send an email to unitrap@crg.es