Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10472B9
Clone ID IST10472B9
Vector VICTR76
Project tigm

Sequence tag IST10472B9HMR1
Sequence
ANGGTGGGGGACTGTTGCTGTAAATCTCTCCNACCCAAATATGCCCCANCAATGAAAACACAACACCATTAATATGAAGA
CATGCTC
Sequence Type genomic DNA
Unitrap ID UNI32802

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 57016200..57016283 80
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024209 (1700061G19Rik) NM_030141 RIKEN cDNA 1700061G19 gene Gene [Source:MGI Symbol;Acc:MGI:1925875]


Sequence tag IST10472B9BBF1
Sequence
CACCCTCCACCACCTCAGGTGGATGGAGGTCAAAGGTCACTCCAAAAGACTGGGACAAAGGACAGGAGTGCTGTTCACTG
CTCCCTGACCCACAGAAAGGAGAACATGGAGTCAGGGTTACTGTTCCCAAATGGACAAGGCCTTGATGGTTGGTCACATG
ATCGCCCTGGCAAAGGTCACATGGCCATAGGTATCACCCTTACTCCTTCCCCCGGTTACTTAAGCCCTCTCCACAGGACT
TCAACGGCNACTGACCACCTACCCCANTANACCNNTGCTGCTCTACTACTGATCCNANAAGTGTGCCTGGGCTGACAAGA
NGACCCTGCTGCCACCCCCACCCTCTCCCTGCACGGGGTGGGGGGCANGGCTCCCACCTGGGGTCAGTATCTNANAGTTA
TCTGCTTGTGCCTTCTTCNATATTGCACTGTGAATTTTGTTCTTCAAGATGGTTTTGGTTTTCANGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 57015728..57016196 443
NO GENE  


Sequence tag IST10472B9HMF1
Sequence
CACCCTCCACCACCTNAGGTGGATGGAGGTCAAAGGTCACTCCAAAAGACTGGGACAAAGGACAGGAGTGCTGTTCACTG
CTCCCTGACCCACANAAAGGANAACATGGAGTCAGGGTTACTGTTCCCAAATGGACAAGGCCTTGATGGTTGGTCACATG
ATCGCCCTGGCAAAGGTCACATGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 57016013..57016196 178
NO GENE  

 
Come back to gene ENSMUSG00000024209


For any suggestions or comments, please send an email to unitrap@crg.es