Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AD0697
Clone ID AD0697
Vector pGT0lxr
Project sanger

Sequence tag AD0697
Sequence
CTTATTTTCCATATTTTATGTAGTGAAGAACTGATCAAAAAAGAAATGATTACGATGCTTCATTATGATCTTCTACATCA
TCCCTACGAACCATCTGGAAATAAAAAAGGAAAAAATGTTGGGTTTGCTACCAACAATTCAGAGCACATTACCTATCTTG
AGCACAGCCCTTATGAGAAGTTCTCCAAAGAAGATCTGAAAAAGGCCCAGGATGCTCTGGTACAAGAGATGGAAGTGGTC
AAACAAGGAATGAGCCATGGCGAACTCTCCAGTGAAGCTTACAACCAGGTGTGGGAGGAATGCTACAGTCAAGTCCTCTA
TCTTCCTGCTCAGAGCCGCTACACTCGTGCTAATCTTGCTAGCAAAAAGGACAGAATTGAATCACTTGAAAAGAGACTTG
AG
Sequence Type mRNA
Unitrap ID UNI1549

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 45541543..45544927 202
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023932 (Cdc5l) NM_152810 cell division cycle 5-like (S. pombe) Gene [Source:MGI Symbol;Acc:MGI:1918952]

 
Come back to gene ENSMUSG00000023932


For any suggestions or comments, please send an email to unitrap@crg.es