Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14191G2
Clone ID IST14191G2
Vector VICTR74
Project tigm

Sequence tag IST14191G2HMR1
Sequence
NTANTTGTACCGGGNNCCTCACAGACTGTAAGAGCTGTATCATTTCTAGAAGTCGCCTAAATGATTCTCCAGGCTTCTAA
TATATACTTCTACAGTTACATGCTGACAGAAACCTGACCCTTGGTTTGATAATCTGCAGTCAAAAGTAGAAGAGGGGAGG
GCTCCCGAAGGCACATN
Sequence Type genomic DNA
Unitrap ID UNI770

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 65204310..65204484 169
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029178 (Klf3) NM_008453 Kruppel-like factor 3 (basic) Gene [Source:MGI Symbol;Acc:MGI:1342773]


Sequence tag IST14191G2BBF1
Sequence
CTACTTCCTAAGGGAGGCAATGAATGGANGNGGAGGCTAACTAGAGCCAANNNNNNNGTTTGCTGAGGACAAAGCAAGAC
TTGCCTGACATTCCCTCTCCTCTCTTCAGGCCTGACCCTAAGGCTTGCCCCAATTACCTGCTCCCTTCAAAGGGGAACCT
CAGCCAGGTGTCCAGAGAACAGACTACTTAGACAACCCAACAAGCAACAATCGCCAGCACCTTCTTCACGCTCCCAAGCG
AATTTTCAAAAGAGGAAGTAAGTATGTTGCTAGTCCCCACCCTCACTCTCCAAAGGAACTGACAGGGTAAAGATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 65203996..65204312 299
 
EST/CDNA Est Name
  BY233738.1 - BM123823.2

 
Come back to gene BY233738.1 - BM123823.2


For any suggestions or comments, please send an email to unitrap@crg.es