Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11254A5
Clone ID IST11254A5
Vector VICTR76
Project tigm

Sequence tag IST11254A5HMF1
Sequence
CTGATGACCTCTTCTGGTGCATCTGAANATAGCTACAGTGA
Sequence Type genomic DNA
Unitrap ID UNI6310

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 35035563..35035602 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 88676453..88676492 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 86591096..86591135 38
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018425 (Dhx40) NM_026191 DEAH (Asp-Glu-Ala-His) box polypeptide 40 Gene [Source:MGI (curated);Acc:Dhx40-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21569628..21569667 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 88897732..88897771 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 87179704..87179743 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 46083586..46083625 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 71248408..71248447 38
NO GENE  


Sequence tag IST11254A5BBF1
Sequence
CTGATGACCTCTTCTGGTGCATCTGAAGATAGCTACAGTGTACTTACATATAATAAATAAATAAATAAATAAATAAATAA
ATAAATCTTTAAAAAAAAAAAAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21569628..21569729 102
NO GENE  

 
Come back to gene ENSMUSG00000018425


For any suggestions or comments, please send an email to unitrap@crg.es