Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15029B7
Clone ID IST15029B7
Vector VICTR78
Project tigm

Sequence tag IST15029B7HMF1
Sequence
CACTGTTGCTGTCTTCAGAAGAGGGCATAAGATCCCATTACAGATGGTTGTGAGCCACCATGTGGTTGCTGGGAATTGAA
TGCAGGACCTCTGGAAAAGCAGACAGTGCTCTTAACCACTGAGCCATCTCCCCAGCCCCTGTTTGAGTGTTTTACATATT
TAAATTACTCAGGCTGGCCTTGAATTTAGGATCTGACTGACTCAGCCTCCCTCATGGAGACCATCAGACCTGGTCAGTGA
AATACTGCTTTTGCATTAAATTACTGAANAGATCATTATTGACCTAACCAGTAAGTAAATGTCCAAGAAGAATGTGTGGA
GCCAGGTGCANAAAGTCAAATACTGTGGGGGANATNAANAATTTNNNACN
Sequence Type genomic DNA
Unitrap ID UNI13061

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84864913..84865276 354
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073633 (Fbxo36) NM_025386 F-box protein 36 Gene [Source:MGI (curated);Acc:Fbxo36-001]


Sequence tag IST15029B7BBF1
Sequence
CACTGTTGCTGTCTTCAGAAGAGGGCATAAGATCCCATTACAGATGGTTGTGAGCCACCATGTGGTTGCTGGGAATTGAA
TGCAGGACCTCTGGAAAAGCAGACAGTGCTCTTAACCACTGAGCCATCTCCCCAGCCCCTGTTTGAGTGTTTTACATATT
TAAATTACTCAGGCTGGCCTTGAATTTANGATCTGACTGACTCANCCTCCCTCATGGAGACCATCANACCTGGTCAGTGA
AATACTGCTTTTGCATTAAATTACTGANNANATCATTATTGACCTANCCANTNAGTNAATGTCCNANANNAANGTGTGGA
NCCAGGTGCNNANNGTCNNNNACNGTGGGGGATNNNANNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000073633


For any suggestions or comments, please send an email to unitrap@crg.es