Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_97H4-3
Clone ID CMHD-GT_97H4-3
Vector Gen-SD5
Project cmhd

Sequence tag CMHD-GT_97H4-3
Sequence
AGTCTTTACTGACACCACGTTTGGCTCCCAGCAAACCCTTCACCGGCTGCATCCGCCACTTTGTAATTGACAGCCGCCCT
GTGAGCTTCAGTAAAGCTGCCCTGGTCAGTGGTGCTGTGAGCATCAACTCCTGTCCCACAGCCTGACACAGCTGCAAGGC
TGCTGAAGACAGCTCTTCCTAACACTGAAATAAACATAGTAGTGGGGGGTCGGGAGGGTCAGAGGCCTGGAACTCCCCTC
CCTACTGAAGCTCTCACCTGGTTGAAGGGGATTTCAATAAATCAGAGACCAGCCG
Sequence Type mRNA
Unitrap ID UNI14117

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 38829694..38829988 295
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019846 (Lama4) NM_010681 laminin, alpha 4 Gene [Source:MGI Symbol;Acc:MGI:109321]

 
Come back to gene ENSMUSG00000019846


For any suggestions or comments, please send an email to unitrap@crg.es