Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12641B6
Clone ID IST12641B6
Vector VICTR76
Project tigm

Sequence tag IST12641B6HMF1
Sequence
TTGATTATATGTAAGTACACTGTAGCTGTCTTCAGACACTCCAGAAGAGGGAGTCAGATCTCATTACAGATGGTTGTGAG
CCACCATGTGGTTGCTGGGATTTGAACTCTGGACCTTTGGAAGAGCAGTCGGGTGCTCTTACCNNCTGANCNNNCTCACC
NNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 30875486..30875645 148
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 100773286..100773445 148
NO GENE  


Sequence tag IST12641B6BBF1
Sequence
TTGATTATATGTAAGTACACTGTAGCTGTCTTCAGACACTCCAGAAGAGGGAGTCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI1454 UNI32395 UNI32426 UNI32427 UNI34288

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 24608410..24608470 61
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 3236080..3236140 61
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 6006886..6006946 61
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023805 (Synj2) NM_011523 synaptojanin 2 Gene [Source:MGI (curated);Acc:Synj2-004]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 13128114..13128174 61
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022545 (Ercc4) NM_015769 excision repair cross-complementing rodent repair deficiency, complementation group 4 Gene [Source:MGI (curated);Acc:Ercc4-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 57918846..57918906 61
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 3513602..3513662 61
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 11232259..11232319 61
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 7626840..7626900 61
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 9513549..9513609 61
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 30875486..30875546 61
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 19237562..19237622 61
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 32246752..32246812 61
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 39250461..39250521 61
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 13541322..13541382 61
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 65977054..65977114 61
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029203 (Hip2) NM_016786 ubiquitin-conjugating enzyme E2K (UBC1 homolog, yeast) Gene [Source:MGI (curated);Acc:Hip2-003]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 36534047..36534107 61
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 14620562..14620622 61
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7610673..7610733 61
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 29734206..29734266 61
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039787 (Cercam) NM_207298 cerebral endothelial cell adhesion molecule Gene [Source:MGI (curated);Acc:Cercam-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 60374274..60374334 61
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073664 (Nbeal1) neurobeachin like 1 Gene [Source:MGI Symbol;Acc:MGI:2444343]

 
Come back to gene ENSMUSG00000073664


For any suggestions or comments, please send an email to unitrap@crg.es