Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14267E8
Clone ID IST14267E8
Vector VICTR74
Project tigm

Sequence tag IST14267E8HMR1
Sequence
NAGAGCGGCCGGGTTAGAGAGGCTAGCCTGGGCAGCGCCGCCGGGGTCGGGAGGCGTGGCAGGTGTCCTGGGGTTTCCCT
TGACCTCTGANAAAGCTAACAACTTCCTACGGCTTTGCTTCTAGAGCTTTCTTANGCCC
Sequence Type genomic DNA
Unitrap ID UNI6711

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 50138689..50138826 134
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020368 (Canx) NM_007597 calnexin Gene [Source:MGI (curated);Acc:Canx-001]


Sequence tag IST14267E8BBF1
Sequence
CTCTCCTCACTGCCCTGCGCGTCCGCCCAGGCCTGCGCCATTCGAAAGCCCGCCCGACCCCTCAGTCGTCGAGCCTACAG
CCACGCCCGACCCCCTCCGCCACGGCGCCGCTCGCCCAGTCCCCCAAGGCTCGTCCCGGGCCTGAGATCCCCGCACACGC
TTCCCGTCTCACCTCGAGCCTCCCGGGGACCACTGGCGGCTCCCTCACCTTCTCCCACCCGCACACCCGGCCCCGTGCTG
CAGTGGAGACAGCGGCAGANGCGGCCCGACCGTCACGTGCCGCANAACTAAGAGGCCTCGGCTACGGCCGCCGCGCGAGC
GAGCCCCACCGCACGAAGCCCAACCCCGCGTCCGCCCCTCGTTCCTGAGTGGCTNAAACGAACGTCAGATCCCGCCCCTT
TGCGCNAGANCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 50138823..50139234 402
 
EST/CDNA Est Name
  NM_007597.2 - BC012408.1

 
Come back to gene NM_007597.2 - BC012408.1


For any suggestions or comments, please send an email to unitrap@crg.es