Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14448B11
Clone ID IST14448B11
Vector VICTR74
Project tigm

Sequence tag IST14448B11BBF1
Sequence
GAAGTTACGCAAAGGCTGAGAGAGGCAAACCAGGAGGTTGGTGACTAGCCNCTGGATCTGCAGAGGCCTCAAGAAACTCA
GTTTGTAATTTCCACTTACAGCAAGGAGATAAGAATAAAGAGAGTAACAGAACTTGTGTGCGGCTAAGGCACTGCTTAAA
GAACATTATACCCCACCTGTGTTTGACTCGGCGACACCGGCCTGCCCCACACAGACTGCCCAGTTGATAATTTAGTCCGT
CTCTCTTTACTAAGTGAACCTTTTTCAACTGATGTCAAAGCTTCAGCTGCCTGAACACTAGAAGAAAAAAAGTCAAGANT
CTGTGCCGTTGGCCTANGATAACCNCTGCTCAGANACAGCCCTTCCATGCAGCCTGACTGGGTCTCAAAGCNNNAACTAG
ATGTGGTGAGTTTCCNNNTGGACCCTGANNNTGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165707820..165708247 406
 
EST/CDNA Est Name
  AK003657.1


Sequence tag IST14448B11HMR1
Sequence
NTCTTGGGCTGAAAGGAAACTTGAGGGCAAAGCGTTTGTCCTCTAAGANCACGCATTAAAATGGCTCCTACAGGTTTGGG
AAGCCAGGATCTGTTTGTGAGTGTGAACCTCANCCAATTTCCCAGCCCTGACTCAAGCTGGCTGCTTTTCCTCGT
Sequence Type genomic DNA
Unitrap ID UNI29535

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165707668..165707821 150
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039671 (Prkcbp1) NP_081506 protein kinase C binding protein 1 Gene [Source:MGI (curated);Acc:Prkcbp1-010]


Sequence tag IST14448B11HMF1
Sequence
GAAGTTACGCAAAGGCTGAGAGAGGCAAACCAGGAGGTTGGTGACTAGCCACTGGATCTGCAGAGGCCTCAAGAAACTCA
GTTTGTAATTTCCACTTACAGCAAGGAGATAAGAATAAAGAGAGTAACAGAACTTGTGTGCGGCTAAGGCACTGCTTAAA
GAACATTATACCCCACCTGTGTTTGACTCGGCGACACCGGCCTGCCCCACACANACTGCCCAGTTGATAATTTANTCCGT
CTCTCTTTACTAAGTGAACCTTTTTCAACTGATGTCAAAGCTTCAGCTGCCTGAACACTAGAAGAAAAAAAGTCAAGANT
CTGTGCCGTTGGCCTANGATAACCNCTGCTCAGANACAGCCCTTCCATGCAGCCTGACTGGGTCTCANAGCANGNNCTAG
ATGTGGTGAGTTTCCANGTGGACCCTNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165707820..165708245 404
 
EST/CDNA Est Name
  AK003657.1

 
Come back to gene AK003657.1


For any suggestions or comments, please send an email to unitrap@crg.es