Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_96H11-3
Clone ID CMHD-GT_96H11-3
Vector pGT6
Project cmhd

Sequence tag CMHD-GT_96H11-3
Sequence
AAATACCAGAGGGGCACCAGGGTCCGGCTGCGTCTCCTGGATCTTGAGCTGACATCTAGGTTCCTGGGTGGGACCACAGA
TACAACTATACTGGAGGCTGATGCAGTTCTCTTAGGACTCCAAGAGATCAGGGACTCAAAATCAAGAGAGGAGCAACCCA
GCAAGTAATGGACTGCGC
Sequence Type mRNA
Unitrap ID UNI12869

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 8802236..8802413 178
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040269 (Mrps28) NM_025434 mitochondrial ribosomal protein S28 Gene [Source:MGI (curated);Acc:Mrps28-001]

 
Come back to gene ENSMUSG00000040269


For any suggestions or comments, please send an email to unitrap@crg.es