Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14590A2
Clone ID IST14590A2
Vector VICTR74
Project tigm

Sequence tag IST14590A2HMR1
Sequence
TACAAAACTGTGACAGANNNANCTAGTTATGTTTGTCTTTGTAAATAGATTAGACAAACAGTTTGGTTATAGTTGCTGCC
TGGCAGGAAACTGCANTACNGGCAATTTTNNNNNNNCACTAAAGTTGTGAAGAACGTTTTAACTGTAAGTCATCTTAAGA
AAGAGTATCAAAATTTGGAGGCGTAGACAGTTATATTGTTTCTCTANAATCGGTCCTTATTACAGGAGGGCCAANATGCT
CANATTAAAAAGTATTTTACGTTTGAGTCAATGCAGGGCTCTGGGCAGCCCCANANCGGCTTGTGGCCTTTCTTTTGTTT
NGCAAACAGTGCCTGANAAAGATTTTTCCCTGTGTTCAAGAGAAATTCTTTTTAACAGTGTTGCANATCTATTCAGATGT
TTAANATNNNACTTANNTTCNAAGAGTTTTGATTCTAGTGAACTGTNNTCACTNNNNNATTNTGCCTCTAANTNTGGCNN
ATGTNNCNNNACATTNTGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14590A2BBF2
Sequence
GTATGAAGTGAGCTGTATGAGCACTCTCATAAGATGATTACTCTTGTAATTATCTTAATTACAGTATACAGGTGAATTAA
AGATCTG
Sequence Type genomic DNA
Unitrap ID UNI15588

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 7803475..7803560 86
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 29593589..29593674 86
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 41653598..41653683 86
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039431 (Mtmr7) NM_001040699 myotubularin related protein 7 Gene [Source:MGI Symbol;Acc:MGI:1891693]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 67604575..67604660 86
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 60550382..60550467 86
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 40553841..40553926 86
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 44881397..44881482 86
NO GENE  


Sequence tag IST14590A2HMF3
Sequence
GTATGAAGTGAGCTGTNNGAGCACTCTCATAANATGATTACTCTTGTAATTATCTTAATTACAGTATACAGGTGAATTAA
AGATCTTAAATTTGAAATCAAACTGCAAGCTGCAGTCAATGGAACAATAGCAGTTTTAACCATAATTTTTAAGTTTTTTG
TGCAAGGTTAGGATAATACCTGTAACCTTGGGAAAGCAAAACCCAAGTTTAAAACAATTTATTATCTTTAAAATCAATAT
TAGAAGCATTACTATCATATTACGAAGTTTGGATGTCAATTAATACCTATGAATACCTATTAAAGCAAGCTTTAATGCTT
TAATAAAGAGACATTGCTTTAAATCTTATTTTAAATTTTACTATTTAGGATACGAACCACATTAATTATTACCTAAACTA
GAAATATCTTTAGAGACCCAGCCTCTTGGGCTGCCTTATGCCATGTGTCGGANNGACTCTNAACTTGAGTTAC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 40553841..40554312 460
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 7803475..7803946 460
NO GENE  

 
Come back to gene ENSMUSG00000039431


For any suggestions or comments, please send an email to unitrap@crg.es