Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14303C10
Clone ID IST14303C10
Vector VICTR74
Project tigm

Sequence tag IST14303C10HMR1
Sequence
GTCTCCATCTTCNAAGGTAGGAATTACAGGAGGTCTTCCATGCCTGCTCAGCATTGCCTTGGGTTCTGGGGATCCAAATT
TANAACCATCTCCTTATTCCCTTCTTTCCTATCCAGCCCCCCCCCCCN
Sequence Type genomic DNA
Unitrap ID UNI31727

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 51287269..51287395 123
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078750 (AC105966.11)  


Sequence tag IST14303C10HMF1
Sequence
GAGACAGAATCCCCAGAGCAAGTTAGCTACCAAGACTAGCTCTATGGAATGAGCTCTGGGTTTGACTGAGAGATCCTGCC
TCAAGGAGACCTGGCTGTCCTGGAACTCTATGGAGTTGAAGAGAATCACAGAGATTTAAGACTTGTGTTGCTCAAACCAG
CCGAAAACAATTTGTCTCTTTTACAAAACAAACTGAGCGGGTCGTGGTAGTGTACACTTTTCATTGNNNCACCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 51287391..51287623 227
NO GENE  


Sequence tag IST14303C10BBF1
Sequence
ATCNGGAGACCCCTGCCCAGGGACCACCGACCCACCNCCGGGAGGTAANCTGGCCNNCA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000078750


For any suggestions or comments, please send an email to unitrap@crg.es