Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14042B4
Clone ID IST14042B4
Vector VICTR74
Project tigm

Sequence tag IST14042B4HMF1
Sequence
GGTTATAGTTCCTGGCATTTGCACNAATGCCTACATTCCAGTGAGTGGTCCCACTGTATCCTCAGGAAACCCCTGCAGTC
TANAATTACCATGTTCCATTTACAGGTGAGAGAACCAAGACTCTGGTTTACATACTCAGGCACAATGCCTGAGGCATTCG
CCGTCCATAGGCAGAAACTGAGATTTGGATGCACCCTTCAGTTATGCTGTGAGTGGGATGGTATTCTTACAAGGCCTGCA
TTGNNNNTTATTAACTCTGCCTCCATGATGTTGTGTGAATCTGAGCAGTCAATTATCCTCAGCTTTACTGGTGAAGCATG
AGAGCCACTCAAAGATGAGCTTTGACTTCAGGCCACCAATACTGCAAATCTATCCCAATAGGAGACAACCAGGGAGAGTC
TGCCCTGANTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 103956941..103957351 397
NO GENE  


Sequence tag IST14042B4BBF1
Sequence
GTCCTCCGTTCTTTTTTGGGGGGGAGGGATAGGAGTGACTTAAATTCTCCCTGTCCGAGGAGATATAAATAACTCCATGT
AAAATTAATGCAGTTCTCGGTAAGTTTAATTCTTTGTTTTGTGTTGAGATGATAGAGACTATTTAGCTTCANAGAGTGTA
GACAAGTTGCACTGTTTCAGAAAATGGCCACTTTACATTCCGTGCATACCTTCTTGGTGCACCTAGATTACCTTGCTCTG
TTTAGCTTTTGCATGCCCTTCAACTAANATTTTCCTAGTTTAATATCAACAAGACAGATGCAAGAAGGGCTAATCAGTTT
TCATGGGCATACAGAAGCAAAGCACTTTGTCTTTGCATTGGGTAAACTTAACTGTTTTCCAAATAATTTTCCTTTGTTCN
AGTGCACTGAAGCTTTTCTACNGAATNNGATGAGTTTTANNNNGTTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI15573

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 120487711..120488165 435
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032897 (Nfyc) NM_008692 nuclear transcription factor-Y gamma Gene [Source:MGI (curated);Acc:Nfyc-002]

 
Come back to gene ENSMUSG00000032897


For any suggestions or comments, please send an email to unitrap@crg.es