Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14957F8
Clone ID IST14957F8
Vector VICTR76
Project tigm

Sequence tag IST14957F8HMR1
Sequence
NGGGTAGGGAAGTTGGGGAGTTCTTGGGACCNGTGTANTTGTTGGGGTGACCTGAAGTCTATGCAGGACTTAATGAAGCT
GTGATGTANCCAGTCAGTGGTTTTTCTTGGGACTAGTCAGAAATGATCTGCCTTANAAATTGGGTTTGTTTCTTTGTTTC
TTTATTTAGAGACTGGCTGGGTCCATCTATGTAGCCAAGGGCCTCTGTCTCTGCTTCCTANCTGCTAGGTTTACAGGCAA
GTGTGGCCN
Sequence Type genomic DNA
Unitrap ID UNI34300

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 125972600..125972846 237
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001482 (Def8) NM_054046 differentially expressed in FDCP 8 Gene [Source:MGI (curated);Acc:Def8-003]


Sequence tag IST14957F8BBF1
Sequence
CCAGAACCCCCTGCCCTCCTACCTTTCTGGTCTCAAGAAGGTGAGGGTCTACCCACAGATACTGCAGCCATTAGACTCTT
CTCCTTAAATCTCGGCTCTGAGTTTGCTCCAAGAGTTCACTAAATGCCAACCTTGGGTGGCCCTGGGACTCAACAGTGTT
TCCCCAGAATCAGACCCCTGCCCTGTAGACCAGAGACTCTCCCTTCCTGTGCTGCAACCCTTGATGCAGCTTCCCCTGCT
GTGTAGACGTCTATCCTCAACCGTAAAGTTACTTTCACTGCTACTTCATAACTGCAATTCTACTGTTATAAATN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 125972289..125972601 313
NO GENE  

 
Come back to gene ENSMUSG00000001482


For any suggestions or comments, please send an email to unitrap@crg.es