Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11174E10
Clone ID IST11174E10
Vector VICTR76
Project tigm

Sequence tag IST11174E10BBF1
Sequence
GCTGGGATTTGAACTCTGGACCTTTGGAAGAGCAGTCGGGTGCTCTTACCN
Sequence Type genomic DNA
Unitrap ID UNI29702 UNI31011 UNI31012 UNI31013 UNI31014 UNI31015

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 59813596..59813645 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 8247839..8247888 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 6228234..6228283 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020456 (Ogdh) NM_010956 oxoglutarate dehydrogenase (lipoamide) Gene [Source:MGI (curated);Acc:Ogdh-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 9791619..9791668 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 58807453..58807502 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 9006517..9006566 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 5915708..5915757 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 16988043..16988092 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063358 (Mapk1) NM_001038663 mitogen-activated protein kinase 1 Gene [Source:MGI (curated);Acc:Mapk1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 3329857..3329906 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 34142837..34142886 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 3831685..3831734 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20819481..20819530 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 69543241..69543290 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027787 (Nmd3) NM_133787 NMD3 homolog (S. cerevisiae) Gene [Source:MGI (curated);Acc:Nmd3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 26538301..26538350 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 103010976..103011025 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000057315 (Arhgap24) NM_146161 Rho GTPase activating protein 24 Gene [Source:MGI (curated);Acc:Arhgap24-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 17265463..17265512 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007655 (Cav1) NM_007616 caveolin 1, caveolae protein Gene [Source:MGI (curated);Acc:Cav1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 22219092..22219141 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 3273291..3273340 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21087670..21087719 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7374307..7374356 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031153 (Gripap1) NM_207670 GRIP1 associated protein 1 Gene [Source:MGI (curated);Acc:Gripap1-002]


Sequence tag IST11174E10HMF2
Sequence
GCTGGGATTTGAACTCTGGACCTTTGGAAGAGCAGTCGGGTGCTCTTACCCACTGAGCCATCTCACCAGCCCTTATTATG
Sequence Type genomic DNA
Unitrap ID UNI5651 UNI15045

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 70674924..70675000 77
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020817 (Rabep1) NM_019400 rabaptin, RAB GTPase binding effector protein 1 Gene [Source:MGI (curated);Acc:Rabep1-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165697942..165698018 77
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039671 (Prkcbp1) NP_081506 protein kinase C binding protein 1 Gene [Source:MGI (curated);Acc:Prkcbp1-010]

 
Come back to gene ENSMUSG00000039671


For any suggestions or comments, please send an email to unitrap@crg.es