Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12057F8
Clone ID IST12057F8
Vector VICTR76
Project tigm

Sequence tag IST12057F8BBF1
Sequence
GAGGCAGGTGGGAAGGGATGGGCTGCACCTCCTGGCCNTTGCTGAGATTGAGGGTGGGCCTGGAGGTGACTCTCTTTTCC
TCTTTTTCTCTGCACTTTTTATTGCACCGGCCCCTGCTGTCCCCTTCTCTGTCCCTCTGGCAATAGTGCCCCACACGCTG
GTACTGGAAGCTGGTTCCTGTAAGTGAGGCTGTCTGTTTTGTCTTGTCTGCCTGTCCTGCTTGTTTCTGTCTTGTCTGTG
TCATTTCTGCTTGATTGCCTGCACACCCCAACCCCCAGCTGTGAGCAATGGAGGTAGCACTCCANCCCTGGGGACTGAGA
NAACTCTTTGGAACTTGAGATGGGGGGAGGGGAGGACCTCTGTCNTTANCAGGGGTANANCTNGNCNTGTTTGTGCATGT
CNGTNNTCCTGCTGANGCANGAGGATTGCAAATTTNNNGNCNNCCTANGGCATATCNNNANTCNNTGTCNTAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12057F8HMF1
Sequence
GAGGCAGGTGGGAAGGGATGGGCTGCACCTCCTGGA
Sequence Type genomic DNA
Unitrap ID UNI14651

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 3599071..3599105 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044433 (2310057J16Rik) NM_027171 RIKEN cDNA 2310057J16 gene Gene [Source:MGI Symbol;Acc:MGI:1916947]

 
Come back to gene ENSMUSG00000044433


For any suggestions or comments, please send an email to unitrap@crg.es