Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_70.1H9-3
Clone ID CMHD-GT_70.1H9-3
Vector pGT8
Project cmhd

Sequence tag CMHD-GT_70.1H9-3
Sequence
GGCCTGTTCGGATTCCGCAGTAGCAAGAGGCAGGAGCCATGGATTGCGTGTGAGCTTTACCAGGGGTTATGCAGAAATGC
CTGCCAGAAATATGAGATCCAGTACTTAAGTTGCCCAAAGACCAGGAAGTGCTGCCTCAAATATCCTAGGAAGATTACCA
GCTTCTAACTCTGTGAGGGAGCCTGGCTTGCCCACCACAAATGCTTCAAGCTACACTCAGGTTTGAATGTCACCGGCATC
ATCCCTTCTTGTAGTAATTTTTCCTATG
Sequence Type mRNA
Unitrap ID UNI14123

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 152364487..152364754 268
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044249 (Defb29) NM_001001444 defensin beta 29 Gene [Source:MGI (curated);Acc:Defb29-001]

 
Come back to gene ENSMUSG00000044249


For any suggestions or comments, please send an email to unitrap@crg.es