Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14190A11
Clone ID IST14190A11
Vector VICTR74
Project tigm

Sequence tag IST14190A11HMR1
Sequence
CTACCCACTAAAGGAATGAATGCAGATTTCTTATTAACACTTGTACACATATCCAGATTTANAACAACAGAAGAATATAA
ACAGCATATACCTTGTGTATAACGCATAGACAGAAGAACTGTTGTCCAAAATAGGCATCATCATGGGAGGGCGTTAAGAG
GCATTTTGTCC
Sequence Type genomic DNA
Unitrap ID UNI12962

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 96489824..96489993 168
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038354 (Ankrd35) NM_001081139 ankyrin repeat domain 35 Gene [Source:MGI (curated);Acc:Ankrd35-001]


Sequence tag IST14190A11HMF1
Sequence
GTAGTCCCACAACATCTAAATTCATATGTAAATGAGTGGTTTANAATATATAAAATATGTCTCCTTGCCTGACANCNCTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 96489749..96489827 73
NO GENE  

 
Come back to gene ENSMUSG00000038354


For any suggestions or comments, please send an email to unitrap@crg.es