Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14315D6
Clone ID IST14315D6
Vector VICTR74
Project tigm

Sequence tag IST14315D6HMR1
Sequence
GTTGCTGATGCTCAAATCTATGGTTCCAGATTTCTTTCCTAGGGTTTCTATCTCTAGTGTTGCCTCGCTTTGAGTTTTCT
TTATTGTGTCTACTTCCCTTTTTAGGTCTAGTATGGTTTTGTTCATTTCCATCACCTGTTTGTATGTTTTTTCCTCTTTT
TCTGTAAGGACTTCTACCTGTTTGATTGTGTTTTCCTGTTTTTCTTTAAGGACTTGTAACTCTTTAGCAGTGTTCTCCTG
TANTTCTTTAAGTGATTTATTAAAGTCCTTCTTGATGTCCTCTACCNTCATCATGAGATATGCTTTTAAATCTANGTCNA
NGTTCTCAGGTGTGTTGNGGTTCCCTGGACTGGGCNAANTGNNTNTNCN
Sequence Type genomic DNA
Unitrap ID UNI29644 UNI30806 UNI30807 UNI30808 UNI30809

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 7324007..7324367 345
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 5255143..5255503 345
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019769 (Syne1) NM_022027 synaptic nuclear envelope 1 Gene [Source:MGI Symbol;Acc:MGI:1927152]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 23740016..23740376 345
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 9689224..9689584 345
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 4073696..4074056 345
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033715 (Akr1c14) NM_134072 aldo-keto reductase family 1, member C14 Gene [Source:MGI (curated);Acc:Akr1c14-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 3176279..3176639 345
 
EST/CDNA Est Name
  CA466174.1 - CN832828.1 - BU743854.1 - BE850839.1 - CN840987.1 - CA531036.1 - BI112273.1 - CA464211.1 - BE134712.1 - BU782242.1 - BU788456.1 - CA466541.1 - BY080252.1 - BQ889010.1 - BU696942.1 - BU695522.1 - BU698916.1 - DV072109.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 4369183..4369543 345
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049148 (Plcxd3) NM_177355 phosphatidylinositol-specific phospholipase C, X domain containing 3 Gene [Source:MGI (curated);Acc:Plcxd3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 14814531..14814891 345
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 11691656..11692016 345
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023826 (Park2) NP_057903 Parkinson disease (autosomal recessive, juvenile) 2, parkin Gene [Source:MGI Symbol;Acc:MGI:1355296]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 10880710..10881070 345
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 20828674..20829034 345
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 7842697..7843057 345
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 4169463..4169823 345
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 5641072..5641432 345
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049119 (1700012H17Rik) NM_173426 family with sequence similarity 110, member B Gene [Source:MGI Symbol;Acc:MGI:1916593]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 6401702..6402062 345
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 3769995..3770355 345
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 5110000..5110360 345
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 5270219..5270579 345
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 4770707..4771067 345
 
EST/CDNA Est Name
  CJ059242.1 - CJ058870.1 - CJ063968.1 - CF535151.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166307: 48442..48802 345
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166335: 5824..6184 345
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166438: 134352..134712 345
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 4905902..4906262 345
NO GENE  

 
Come back to gene CJ059242.1 - CJ058870.1 - CJ063968.1 - CF535151.1


For any suggestions or comments, please send an email to unitrap@crg.es