Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12881A12
Clone ID IST12881A12
Vector VICTR76
Project tigm

Sequence tag IST12881A12HMF1
Sequence
CTACAATTCCNGTCCCCTTTAAAATTTTTATTTTGAAAATTACCTAGGCCGGCCTTGAACCCTCCTTGACCTTGTGGTCC
TTCTACCTCCATCTACCGGGNTGGAGGATGCTGGGATTANANACCANCTTGGATAGGCAAGTCTTGACTTTGCCTCTTCA
TTGGANACCTCCTTGGATACAGGCTGGTTTTTTTTGTTTGTTTGTTTNNGTTTTN
Sequence Type genomic DNA
Unitrap ID UNI34310

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 157166638..157166851 198
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027643 (Ghrh) NM_010285 growth hormone releasing hormone Gene [Source:MGI (curated);Acc:Ghrh-001]

 
Come back to gene ENSMUSG00000027643


For any suggestions or comments, please send an email to unitrap@crg.es