Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14989C6
Clone ID IST14989C6
Vector VICTR80
Project tigm

Sequence tag IST14989C6HMF2
Sequence
ACTGTNNNNNANNANNNTNNNANNNNNANNACTGNNNNCNTTTATAATTGATAATTACAGGGAANCATCAAACTATTCAA
TATGATATACACTGGTGAAGCTTCNNAACAATTTCAAAAAATCGTCTTCTAATATATATTTTATTTTCATAAACCTAAAC
TCCATCATAATTTGGTGTANCTTATAAAATCTACAATAAATATATTAGTTATTTTCTCTCACCAGCAAGTTTTAAATCAT
TAATTAAATATACCCAGTTTTTAATGTGTTAAAAAAAAGGTAGAGCAAAAACAAAAGGAAGAAAACTGTACAAAAATTAA
ATTAAAAACACTAATATAAGCTAATACTGCTTACATATGAACATCAAGATGCCNAGGGACCCAATACNNATTNNNANTCT
AANATTTTCAATGGCACAGCCTAGTGATCACACGATACTGGTGATACTCTCTANTTACCCCTGGCAACCTTTCTNAACTG
TAACNATGCTACCCTACAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 44865041..44865498 427
 
EST/CDNA Est Name
  AA119289.1


Sequence tag IST14989C6HMR1
Sequence
NNCNNNGAAAGATTGGGTCNAGAAATTTCATACTTTTAAGAAATCTGACTTTAGTTTTTACCCAAAGCAAAAGTAAAAAT
ATACATGCCAAGCAAGTCCAAGTTAGTAGCATAACAGTTATTACTCTTAATATACTAAATATGATTTTAATAACCAATTT
TAGAATTCTTTAATTTTAGCCTTTCTCCTATTTTTGTACTTCAAGAAATTATTTGTAGTCACATATAAAATGTAAATTCA
GCAATCTCCTACAGTGAGTAGAAGAAAATGCAGAGATTTCAAGATAGTATAAATGTGAAATTTGAAGTATAACTGAGATT
TAAGGTAAAGTAGCAATAGACTCGCAAAGATTAGCTTTAAATTAGATTAGCAGTCC
Sequence Type genomic DNA
Unitrap ID UNI11872

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 44865539..44865907 367
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035649 (Zcchc7) NM_177027 zinc finger, CCHC domain containing 7 Gene [Source:MGI (curated);Acc:Zcchc7-003]

 
Come back to gene ENSMUSG00000035649


For any suggestions or comments, please send an email to unitrap@crg.es