Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11065E11
Clone ID IST11065E11
Vector VICTR76
Project tigm

Sequence tag IST11065E11BBF1
Sequence
ATTTTAGGATTAATGGTATGTGTAACCACACTCCACCACCAGTTTCTATTTCTATTAAAACCTTTCTTTTTTTTTTG

Sequence Type genomic DNA
Unitrap ID UNI30627

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 24979514..24979589 76
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038056 (Mll3) NM_001081383 myeloid/lymphoid or mixed-lineage leukemia 3 Gene [Source:MGI Symbol;Acc:MGI:2444959]


Sequence tag IST11065E11HMF1
Sequence
ATTTTAGGATTAATGGTATGTGTAACCACACTCCACCACCAGTTTCTATTTCTATTAAAACCTTTCTTTTTTTTTTG

Sequence Type genomic DNA
Unitrap ID UNI30627

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 24979514..24979589 76
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038056 (Mll3) NM_001081383 myeloid/lymphoid or mixed-lineage leukemia 3 Gene [Source:MGI Symbol;Acc:MGI:2444959]

 
Come back to gene ENSMUSG00000038056


For any suggestions or comments, please send an email to unitrap@crg.es