Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10050A2
Clone ID IST10050A2
Vector VICTR75
Project tigm

Sequence tag IST10050A2HMF1
Sequence
ATACCAAACCAATTTCTATCTAGCAAGCCCCGGGGCATTAAAACACACCACAGGAGCAGGCAGGAGAGATCAAAGATACA
TCATCATCAGATCTCCTGAGTTAGCCCTCTAGAGTCCCTAACACTTTAGTCTTCTAAGATAGCCTCAAAGCTGCAGAGCT
CAGTTCTGTAGACGTGGAAGAAGGCCCGATCCTCCCTGACTCACCTGTANCATGTGGGACACATCAAANAGAGNGCAATG
CCGGCGTGTGTGCAGGTGTGAATCAACATGACTGTCACGGTATTGTACAGGCAGACTCCACCCTGCAAACGCCACCATTT
TTCCTCCATGAGCTAGGTGGAAGTCATAGAGTGGAGTCCTGCGGAGCACATCCTGTAGACNGCCNGACTTAGTGCCNCCA
GGGCCCCAGTCACCATCAGTTTCCTTCCCCCACCCTCCAAGANNNATAACAAATTCCAGCATCCTTTATCCCACCTGTAC
AGAACTGAGTGGGCGACTCTGGNNNAANGGTTGTGCCTGCANGCNAAANNCCAGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108199297..108199830 500
NO GENE  


Sequence tag IST10050A2BBR1
Sequence
TTATCTAGTAAGGTGTTAGATCGCCTTGAATTTTTAGATGTTGCTTGGTTGCACGGAGGCTGGGAGGGATCCG
Sequence Type genomic DNA
Unitrap ID UNI25498

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108199828..108199899 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032607 (Amt) NM_001013814 aminomethyltransferase Gene [Source:MGI Symbol;Acc:MGI:3646700]

 
Come back to gene ENSMUSG00000032607


For any suggestions or comments, please send an email to unitrap@crg.es