Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_45D6-3
Clone ID CMHD-GT_45D6-3
Vector pGTlox4
Project cmhd

Sequence tag CMHD-GT_45D6-3
Sequence
CTACCTGGGAACTGCTGTTTCTATGCATTAAGATGTCTCTGGTGGACTTGGGGAAGAGGCTGCTAGAAGCTGCAAGGAAA
GGCCAAGACGATGAAGTGAGGACACTGATGGCAAATGGGGCTCCATTCACCACAGACTGGCTCGGAACATCACCGCTTCA
CCTTGCAGCCCAGTATGGTCATTATTCCACAGCAGAAGTGCTCCTTCGAGCTGGCGTTAGCAGGGATGCCCGGACCAAAG
TGGACAGGACCCCTTTGCATATGGCTGCAGCTGATGGACATGTTCACATCGTGGAACTGCTTGTTAGGAGTGGTGCAGAT
GTGAACGCAAAGGACATGCTGCAGATGACAGCTCTGCACTGGGCCAGAGAGCACCATCACGGGGATGT
Sequence Type mRNA
Unitrap ID UNI14182

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95007768..95010524 169
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038766 (Gabpb2) NM_172512 GA repeat binding protein, beta 2 Gene [Source:MGI (curated);Acc:Gabpb2-004]

 
Come back to gene ENSMUSG00000038766


For any suggestions or comments, please send an email to unitrap@crg.es