Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11587A8
Clone ID IST11587A8
Vector VICTR76
Project tigm

Sequence tag IST11587A8HMR1
Sequence
TTCCCAACCCCCACTTCNTTCTTCTTCTAATTCTTTTTCTCTCTTTCTTCCTTTCCTTTCCTTCTTTTCTTTTCTTTTCT
TTTCTTTCGATACTGGGAACCAAACCCGGGTTCTGGAACGCTAGGCTGAACTAAATCTAAATGCTCACACCTGTTTTTTT
CTTTTCTTGTTGTTGTTGTTCTTGTTAGGATAACTTGTTTGGGCAGCGATGTGCNCAATGTTCCTGTGTTTANTTTCTTA
NTTACAGTTTCTTTTGCNGNANTAACTGGGATGAAAGATACTGATAACTTTANGACATTTTCTATNNTTTTCAATATTAC
NGTTTTTTTTTTTNNNAAAAAN
Sequence Type genomic DNA
Unitrap ID UNI24432

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 121544289..121544621 311
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026383 (Epb4.1l5) NM_145506 erythrocyte protein band 4.1-like 5 Gene [Source:MGI Symbol;Acc:MGI:103006]

 
Come back to gene ENSMUSG00000026383


For any suggestions or comments, please send an email to unitrap@crg.es