Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13104H5
Clone ID IST13104H5
Vector VICTR76
Project tigm

Sequence tag IST13104H5HMF1
Sequence
ACCCAACCTAGCAATCCTTCTCCACCTATCCAGGTTTTATCATTGGTGCCATCCTCTTTCTTTCTGGGGTTTACTGGGTC
TGCTTTTTGAGTTGGGGTCTTCTTTTATATCCAAGGCTGCCCTTGAACAGAGCCATTCTCCTAAGCCTCCTAAGTGCTGA
GATTGTAAGTGTGTCTTCGCAGTTAGCTAAGAAATCAGTGTTCAATTCTTAACAGAAGGTAAGTGGCATGTCACGTGATA
CATGTGTTAATCATCTATACTTCTGATGAAGCACAGCATTCTTAGCAATTGGTGTTTTCACAAAAAAAATTCCACGAGAA
CTCAGATAAATGCACTCCAATTTGGTTTGGTTTGGTTTCTCACATGTATGTGTATGTGTGANTTCATACGTTCANGAGGG
AGAATGCNNATACACATGANTTGGAGGCNANAANCNNATGCNGGATCTGATATANGGTCTCNCACTGAAN
Sequence Type genomic DNA
Unitrap ID UNI34320

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 8755694..8756162 443
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052551 (Adarb2) NP_443209 adenosine deaminase, RNA-specific, B2 Gene [Source:MGI Symbol;Acc:MGI:2151118]

 
Come back to gene ENSMUSG00000052551


For any suggestions or comments, please send an email to unitrap@crg.es