Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_24B8-3
Clone ID CMHD-GT_24B8-3
Vector pMS1
Project cmhd

Sequence tag CMHD-GT_24B8-3
Sequence
GCACTGCAACATGGTGCTGGAAAATGTGAAGGAGATGTGGACTGAGGTTCCCAAGAGCGGCAAGGGCAAGAAGAAATCCA
AGCCTGTCAACAAGGACCGCTACATCTCCAAGATGTTCCTGCGCGGGGACTCGGTCATCGTGGTGCTGCGGAACCCACTC
ATCGCTGGCAAGTAGAGCCTGCTCCCTGCCCTGCGAAGGCCTGCAGAACCCTGCCCAGTGGGCAAGAAATAAAACCCTGT
GCTTTTTGGTT
Sequence Type mRNA
Unitrap ID UNI14190

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 19737825..19738075 249
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040824 (Snrpd2) NM_026943 small nuclear ribonucleoprotein D2 Gene [Source:MGI (curated);Acc:Snrpd2-001]

 
Come back to gene ENSMUSG00000040824


For any suggestions or comments, please send an email to unitrap@crg.es