Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_25C3-5
Clone ID CMHD-GT_25C3-5
Vector pPT1
Project cmhd

Sequence tag CMHD-GT_25C3-5
Sequence
CGAGGATGCCGTACGAGATCAAGAAGGTGTTCGCCAGCCTCCCCCAGGTGGAGCGGGGCGTCTGTAAGATCCTCGGTCGA
GACCCCAAGGGCGATCATTTCCTCTACACCAACGGCAAGTGCGTCATCCTACGAAACC
Sequence Type mRNA
Unitrap ID UNI1301

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 38952325..38952775 108
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005103 (Wdr1) NP_035845 WD repeat domain 1 Gene [Source:MGI Symbol;Acc:MGI:1337100]

 
Come back to gene ENSMUSG00000005103


For any suggestions or comments, please send an email to unitrap@crg.es